ID: 1171444729_1171444742

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1171444729 1171444742
Species Human (GRCh38) Human (GRCh38)
Location 20:25195607-25195629 20:25195645-25195667
Sequence CCCGCGCCTGCGCAACTGGGTCC CTCTCCCGCCTGCGCATGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 84} {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!