ID: 1171445089_1171445092

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1171445089 1171445092
Species Human (GRCh38) Human (GRCh38)
Location 20:25197018-25197040 20:25197042-25197064
Sequence CCGGTTTTTGCCAAGGAGAGAAA ACCTACTGAAACCCACCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 293} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!