ID: 1171452933_1171452940

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1171452933 1171452940
Species Human (GRCh38) Human (GRCh38)
Location 20:25248485-25248507 20:25248521-25248543
Sequence CCAGCGGGGGTCTCTGCGGGGCG TACCTGCGCCCCTAGCCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 145} {0: 1, 1: 0, 2: 1, 3: 4, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!