ID: 1171462532_1171462540

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1171462532 1171462540
Species Human (GRCh38) Human (GRCh38)
Location 20:25307032-25307054 20:25307076-25307098
Sequence CCTAAGGGAGCAGGGGTGACATT TGCCCTGGCACCTTCTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 149} {0: 1, 1: 0, 2: 6, 3: 80, 4: 495}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!