ID: 1171486390_1171486404

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1171486390 1171486404
Species Human (GRCh38) Human (GRCh38)
Location 20:25489460-25489482 20:25489513-25489535
Sequence CCCCCCTCCTTCTCCTTACTCCC TTCCAGACTTAGATCTAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 25, 3: 363, 4: 2365} {0: 1, 1: 0, 2: 0, 3: 3, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!