ID: 1171500912_1171500918

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1171500912 1171500918
Species Human (GRCh38) Human (GRCh38)
Location 20:25592657-25592679 20:25592700-25592722
Sequence CCTCAGGTGGTTTAAAGTAGGTT TCCTTGCCTGCTGCTGTCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 47, 4: 475}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!