ID: 1171510000_1171510005

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1171510000 1171510005
Species Human (GRCh38) Human (GRCh38)
Location 20:25674491-25674513 20:25674539-25674561
Sequence CCCACCTCCTAATACTTACACTG AGTTTCAACATAAATTAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 428} {0: 1, 1: 0, 2: 23, 3: 258, 4: 788}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!