ID: 1171531029_1171531034

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1171531029 1171531034
Species Human (GRCh38) Human (GRCh38)
Location 20:25853831-25853853 20:25853846-25853868
Sequence CCGCCCGGCGATCCGCCTGAGGT CCTGAGGTTTCTACCTTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!