ID: 1171770389_1171770401

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1171770389 1171770401
Species Human (GRCh38) Human (GRCh38)
Location 20:29318928-29318950 20:29318980-29319002
Sequence CCCACAGGGGGCTTTCGTGAGCG CCTAGCCAGGCTGCGCAGGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!