ID: 1171785953_1171785957

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1171785953 1171785957
Species Human (GRCh38) Human (GRCh38)
Location 20:29464694-29464716 20:29464735-29464757
Sequence CCTTCACTCTTCTAGAAGGACTT TCCATGGTTTAGAATAAAAGAGG
Strand - +
Off-target summary {0: 8, 1: 15, 2: 25, 3: 70, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!