ID: 1171788921_1171788925

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1171788921 1171788925
Species Human (GRCh38) Human (GRCh38)
Location 20:29500463-29500485 20:29500498-29500520
Sequence CCTATACCAGTCAGAATAGCTAC GAAAAACAACAGATCTTGGGAGG
Strand - +
Off-target summary No data {0: 5, 1: 2, 2: 2, 3: 40, 4: 428}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!