ID: 1171797213_1171797229

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1171797213 1171797229
Species Human (GRCh38) Human (GRCh38)
Location 20:29576060-29576082 20:29576106-29576128
Sequence CCAAAATAGTTCTGCTGGTTGAA TGGGGAAGGGGATTAGCCCGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!