ID: 1171810866_1171810876

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1171810866 1171810876
Species Human (GRCh38) Human (GRCh38)
Location 20:29743548-29743570 20:29743583-29743605
Sequence CCGGGCACAACCACCGCTCGCGC GCTAGGACGCCGGCTCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 3, 3: 5, 4: 42} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!