ID: 1171860688_1171860690

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1171860688 1171860690
Species Human (GRCh38) Human (GRCh38)
Location 20:30400168-30400190 20:30400182-30400204
Sequence CCAAATCTGGAGTTACATGGCAT ACATGGCATCTGTACAATCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 1, 3: 5, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!