ID: 1171866122_1171866129

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1171866122 1171866129
Species Human (GRCh38) Human (GRCh38)
Location 20:30488494-30488516 20:30488516-30488538
Sequence CCACTCGGGGTGCCGCCGACCTG GGTCCCAAAGGCGCACGCCCGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 68} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!