ID: 1171903522_1171903526

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1171903522 1171903526
Species Human (GRCh38) Human (GRCh38)
Location 20:30879033-30879055 20:30879077-30879099
Sequence CCGGCAGTTGAGGACCATGTGGA TCCCAACCTGACAGCAGAACAGG
Strand - +
Off-target summary {0: 3, 1: 3, 2: 3, 3: 10, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!