ID: 1171988985_1171988993

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1171988985 1171988993
Species Human (GRCh38) Human (GRCh38)
Location 20:31681117-31681139 20:31681158-31681180
Sequence CCGATTGTGTGGGGCCTGGTAGG TTGTCCTGGGAAAGCACTGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!