ID: 1171997029_1171997044

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1171997029 1171997044
Species Human (GRCh38) Human (GRCh38)
Location 20:31739435-31739457 20:31739488-31739510
Sequence CCCTAGCGCCGTTCGCGCCGCTA GGTCGCCGCCTAGGCGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 5} {0: 1, 1: 0, 2: 0, 3: 7, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!