ID: 1172012345_1172012356

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1172012345 1172012356
Species Human (GRCh38) Human (GRCh38)
Location 20:31852911-31852933 20:31852962-31852984
Sequence CCAGGTGGAGGGGCCTCTTTGTT ACCATCCAGGCCTGGAGGATTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 23, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!