ID: 1172014335_1172014336

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1172014335 1172014336
Species Human (GRCh38) Human (GRCh38)
Location 20:31863928-31863950 20:31863966-31863988
Sequence CCATTAAGGCGGCAGCAGTGGAT TTTGAAGTGCTTTTTGCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69} {0: 1, 1: 0, 2: 0, 3: 19, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!