ID: 1172025272_1172025281

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1172025272 1172025281
Species Human (GRCh38) Human (GRCh38)
Location 20:31944124-31944146 20:31944171-31944193
Sequence CCTTCTGCCTTCAGAGCATGAGG TGAGGCACACCAACCCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 246} {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!