ID: 1172061351_1172061360

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1172061351 1172061360
Species Human (GRCh38) Human (GRCh38)
Location 20:32189412-32189434 20:32189459-32189481
Sequence CCTGTGTACGAGGGCCGGGGGTT GAGTCGCAATAGACACCACTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36} {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!