ID: 1172083288_1172083296

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1172083288 1172083296
Species Human (GRCh38) Human (GRCh38)
Location 20:32358866-32358888 20:32358887-32358909
Sequence CCCGGGGTGGGGGGGGCTCGCCG CGCGCACCCCCCCACTGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 347} {0: 1, 1: 0, 2: 1, 3: 8, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!