ID: 1172100877_1172100891

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1172100877 1172100891
Species Human (GRCh38) Human (GRCh38)
Location 20:32483519-32483541 20:32483564-32483586
Sequence CCCGGGGGCGGGGGTGGCCAGGA CGGCAGCGGCGGCGGCGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 96, 4: 956} {0: 1, 1: 10, 2: 192, 3: 494, 4: 1380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!