ID: 1172100883_1172100892

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1172100883 1172100892
Species Human (GRCh38) Human (GRCh38)
Location 20:32483536-32483558 20:32483569-32483591
Sequence CCAGGAGGAGGGCCCAGGCGAGC GCGGCGGCGGCGCCGCGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 337} {0: 1, 1: 6, 2: 58, 3: 298, 4: 1538}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!