ID: 1172100886_1172100896

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1172100886 1172100896
Species Human (GRCh38) Human (GRCh38)
Location 20:32483548-32483570 20:32483578-32483600
Sequence CCCAGGCGAGCAGCGGCGGCAGC GCGCCGCGGCCCGGAGGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 232} {0: 1, 1: 0, 2: 2, 3: 22, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!