ID: 1172105168_1172105172

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1172105168 1172105172
Species Human (GRCh38) Human (GRCh38)
Location 20:32512704-32512726 20:32512755-32512777
Sequence CCTTAACATTTTGTCATAGGTAT CTTTGTAAGTAGAATTTTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 41, 4: 439}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!