ID: 1172113921_1172113937

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1172113921 1172113937
Species Human (GRCh38) Human (GRCh38)
Location 20:32562876-32562898 20:32562925-32562947
Sequence CCTAAGGAGGGCAGGGAGGGTGG GAGTGGAGAAGGAGGGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 9, 3: 195, 4: 1631}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!