ID: 1172136357_1172136360

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1172136357 1172136360
Species Human (GRCh38) Human (GRCh38)
Location 20:32689389-32689411 20:32689414-32689436
Sequence CCTGTAGTGAATGGGTTGGGAGC GTGTCTATAAGGAGAGAGGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 26, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!