ID: 1172162396_1172162403

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1172162396 1172162403
Species Human (GRCh38) Human (GRCh38)
Location 20:32877807-32877829 20:32877843-32877865
Sequence CCTTACAGGGGCCTGAGTTTTAT GAGTGAATAAAGAGCTCCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!