ID: 1172189783_1172189785

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1172189783 1172189785
Species Human (GRCh38) Human (GRCh38)
Location 20:33054950-33054972 20:33054979-33055001
Sequence CCAGTGGGAAGCAGCTGCTGGAA CTCTCATCCTGCTGTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 291} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!