ID: 1172208930_1172208937

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1172208930 1172208937
Species Human (GRCh38) Human (GRCh38)
Location 20:33184109-33184131 20:33184146-33184168
Sequence CCATGACAGTCTCAGGAAGTCCT AAGGTGATGGGGGCACAGCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 237, 3: 559, 4: 1051}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!