ID: 1172222406_1172222411

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1172222406 1172222411
Species Human (GRCh38) Human (GRCh38)
Location 20:33283047-33283069 20:33283063-33283085
Sequence CCTCAGGAAGCTGGAGTCCCAAG TCCCAAGGCTGCCTCCGGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 282} {0: 1, 1: 0, 2: 1, 3: 27, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!