ID: 1172222414_1172222420

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1172222414 1172222420
Species Human (GRCh38) Human (GRCh38)
Location 20:33283065-33283087 20:33283109-33283131
Sequence CCAAGGCTGCCTCCGGGCGGGGC AATATTTACCTTGGAGACCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 451} {0: 1, 1: 0, 2: 1, 3: 19, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!