ID: 1172225570_1172225581

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1172225570 1172225581
Species Human (GRCh38) Human (GRCh38)
Location 20:33303047-33303069 20:33303091-33303113
Sequence CCTCCGCCCTTTGTTCACCCTGG GCGATATTGGCAGCAACCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 159} {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!