ID: 1172233261_1172233269

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1172233261 1172233269
Species Human (GRCh38) Human (GRCh38)
Location 20:33351525-33351547 20:33351576-33351598
Sequence CCTCCCGAGTAGCTGGGACTACA CTCTGTTGTTGTAGTAAAGATGG
Strand - +
Off-target summary {0: 54131, 1: 174214, 2: 265888, 3: 193370, 4: 113909} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!