ID: 1172233263_1172233269

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1172233263 1172233269
Species Human (GRCh38) Human (GRCh38)
Location 20:33351528-33351550 20:33351576-33351598
Sequence CCCGAGTAGCTGGGACTACAGGT CTCTGTTGTTGTAGTAAAGATGG
Strand - +
Off-target summary {0: 27977, 1: 146191, 2: 244935, 3: 217028, 4: 128877} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!