ID: 1172233268_1172233272

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1172233268 1172233272
Species Human (GRCh38) Human (GRCh38)
Location 20:33351564-33351586 20:33351597-33351619
Sequence CCTGGCTAATTTCTCTGTTGTTG GGGGTTTCTCCATGTTCATCAGG
Strand - +
Off-target summary No data {0: 29, 1: 653, 2: 14861, 3: 39812, 4: 148133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!