ID: 1172240589_1172240593

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1172240589 1172240593
Species Human (GRCh38) Human (GRCh38)
Location 20:33410155-33410177 20:33410168-33410190
Sequence CCCTCGGCGGCCCGGTGACAGCC GGTGACAGCCATCCACAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54} {0: 1, 1: 1, 2: 0, 3: 8, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!