ID: 1172269068_1172269075

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1172269068 1172269075
Species Human (GRCh38) Human (GRCh38)
Location 20:33642963-33642985 20:33642992-33643014
Sequence CCTGCAAAATCACTTTCAAAAGC GGGATAGAGGGCCTGTCCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!