ID: 1172271833_1172271845

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1172271833 1172271845
Species Human (GRCh38) Human (GRCh38)
Location 20:33659464-33659486 20:33659496-33659518
Sequence CCATCCAGCCGCTTGCCCCTCTC CCAAGTCAGGCCCCTTGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 286} {0: 1, 1: 0, 2: 1, 3: 12, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!