ID: 1172331590_1172331594

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1172331590 1172331594
Species Human (GRCh38) Human (GRCh38)
Location 20:34079430-34079452 20:34079458-34079480
Sequence CCTTGGGGTGGCTTGGGTGGAGG CTCAAACACTAGTGTTTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!