ID: 1172357913_1172357916

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1172357913 1172357916
Species Human (GRCh38) Human (GRCh38)
Location 20:34292497-34292519 20:34292510-34292532
Sequence CCAGGCATACACTGGAGGGTGAG GGAGGGTGAGTGGCACATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170} {0: 1, 1: 0, 2: 0, 3: 22, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!