ID: 1172367949_1172367970 |
View in Genome Browser |
Spacer: 29 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1172367949 | 1172367970 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 20:34363878-34363900 | 20:34363930-34363952 |
| Sequence | CCTCCTTCCATTGTCCCCCCGGC | GACGTCCGCCACCGTCGTGGCGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 1, 3: 16, 4: 191} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||