ID: 1172372857_1172372858

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1172372857 1172372858
Species Human (GRCh38) Human (GRCh38)
Location 20:34408784-34408806 20:34408821-34408843
Sequence CCTTACAGTGTAAGCTTGGAAGT TGTTTTGTTTAGTAGATGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 137} {0: 1, 1: 0, 2: 0, 3: 30, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!