ID: 1172400183_1172400189

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1172400183 1172400189
Species Human (GRCh38) Human (GRCh38)
Location 20:34643966-34643988 20:34643985-34644007
Sequence CCCTTCTTTATCTGTTAGTAAAG AAAGCTGTCTTGTGGGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 337} {0: 1, 1: 0, 2: 1, 3: 28, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!