ID: 1172409644_1172409666

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1172409644 1172409666
Species Human (GRCh38) Human (GRCh38)
Location 20:34711631-34711653 20:34711680-34711702
Sequence CCCTCCCCTTCTCCTCCAGTAAA TGGGGGAGACAGAAGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 490} {0: 1, 1: 1, 2: 16, 3: 231, 4: 1017}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!