ID: 1172411591_1172411595

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1172411591 1172411595
Species Human (GRCh38) Human (GRCh38)
Location 20:34727867-34727889 20:34727892-34727914
Sequence CCATGTGACACCACGCCCTGCTA TTTTGTCTTTTTAGTAGAGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 68, 3: 316, 4: 858} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!