ID: 1172436313_1172436324

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1172436313 1172436324
Species Human (GRCh38) Human (GRCh38)
Location 20:34931235-34931257 20:34931287-34931309
Sequence CCCCATGCCCGGGACTGTGCCCA CCTGCTAGTCCCTCTCATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 263} {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!