ID: 1172442754_1172442777

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1172442754 1172442777
Species Human (GRCh38) Human (GRCh38)
Location 20:34977662-34977684 20:34977715-34977737
Sequence CCCTCACCGTGGTGCCGAGGTAG AGGGCAGGAGGGTGGGCGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 81} {0: 1, 1: 2, 2: 23, 3: 686, 4: 8685}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!